View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20037_low_11 (Length: 375)
Name: NF20037_low_11
Description: NF20037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20037_low_11 |
 |  |
|
| [»] scaffold1333 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1333 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: scaffold1333
Description:
Target: scaffold1333; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 43 - 209
Target Start/End: Original strand, 1011 - 1177
Alignment:
| Q |
43 |
tactccctttattgtggctaattaattttgattcatattaattttctagttgcaattagtgtttctgtggttaacgtttgattcaggaatgtaaatgaac |
142 |
Q |
| |
|
||||||| ||||| ||||||||||||||| ||||||||| |||| ||||||||||||||| ||| |||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
1011 |
tactcccattattatggctaattaattttaattcatattgatttcctagttgcaattagtatttttgtgcttaacctttgactcaggaatgtaaatgaac |
1110 |
T |
 |
| Q |
143 |
ttggaactcaaagaggaactatatttattttgtgagattatggaagatgagtacacaataaatttat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111 |
ttggaactcaaagaggaactatatttattttgtgagattatggaagatgagtacacaataaatttat |
1177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 310 - 350
Target Start/End: Original strand, 1174 - 1214
Alignment:
| Q |
310 |
ttatctgacacatggtttaatctgtgtcttttaagaagcat |
350 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1174 |
ttatctgacacatggtttaatctctgtcttttaagaagcat |
1214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University