View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20037_low_22 (Length: 267)
Name: NF20037_low_22
Description: NF20037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20037_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 19091723 - 19091918
Alignment:
| Q |
13 |
aatattgtgggtgtgccaagcaatgcagataccgcttcagaggctgtctttgtgttaaaagtcaatgtagaactcgacaatgtccatgttttgcagcaaa |
112 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| |||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
19091723 |
aatattgcgggtgtgacaagcaatgcagataccgattcagaggatgtctttgtgttaaaagtcagtgcagaactcgacaatgtccatgttttgcagcaaa |
19091822 |
T |
|
| Q |
113 |
acgggaatgtgacccagatgtctgtaaagattgttgggccaggtaatttattttttactatagaattttattgaaagctatattttggtagggttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19091823 |
acgggaatgtgacccagatgtctgtaaagattgttgggccaggtaatttattttttactatagaattttattgaaagctatattttggtagggttt |
19091918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 43 - 159
Target Start/End: Original strand, 38938695 - 38938811
Alignment:
| Q |
43 |
accgcttcagaggctgtctttgtgttaaaagtcaatgtagaactcgacaatgtccatgttttgcagcaaaacgggaatgtgacccagatgtctgtaaaga |
142 |
Q |
| |
|
|||| |||||||| || | ||||| || ||||||||||||| ||||||||| ||||||||||| || ||| |||||||| |||||||||||| | | |
|
|
| T |
38938695 |
accggttcagaggttgccattgtgccaagagtcaatgtagaagtcgacaatgcccatgttttgctgctggacgtgaatgtgatccagatgtctgtcgaaa |
38938794 |
T |
|
| Q |
143 |
ttgttgggccaggtaat |
159 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
38938795 |
ttgttgggttaggtaat |
38938811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University