View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20037_low_32 (Length: 218)
Name: NF20037_low_32
Description: NF20037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20037_low_32 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 22016587 - 22016804
Alignment:
| Q |
1 |
tttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgctatttaccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016587 |
tttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgctatttaccga |
22016686 |
T |
 |
| Q |
101 |
agcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgtaatgaagggac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016687 |
agcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgtaatgaagggaa |
22016786 |
T |
 |
| Q |
201 |
agataataatgaaaataa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22016787 |
agataataatgaaaataa |
22016804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University