View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20037_low_34 (Length: 206)

Name: NF20037_low_34
Description: NF20037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20037_low_34
NF20037_low_34
[»] chr2 (1 HSPs)
chr2 (9-182)||(33744445-33744618)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 9 - 182
Target Start/End: Complemental strand, 33744618 - 33744445
Alignment:
9 ggtagataatacttgccgtacaataaattgatgttttatttacagtaaaataaatttcattcaaattctatatttgtgagagtacaatcaaattgattaa 108  Q
    |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
33744618 ggtaaataatatttgccgtacaataaattgatgttttatttacagtaaaataaatttcattcaaatactatatttgtgagagtacaatcaaattgattaa 33744519  T
109 taacattttccattcacatcctaaaaatcaaaaacattatatcaacacttcaaaatttcagaaagataaaagta 182  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
33744518 taacattttccattcacatcctaaaaatcaaatacattatatcaacacttaaaaatttcagaaagataaaagta 33744445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University