View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20038_high_14 (Length: 211)
Name: NF20038_high_14
Description: NF20038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20038_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 55092726 - 55092936
Alignment:
| Q |
1 |
tcattattaatgtttcaattttaataaattggtggtactatg----------acttaattcaagttaatgttggtcattacatggtgaaacatgagacag |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55092726 |
tcattattaatgtttcaattttaataaattggtggtactatgtagtagtatgacttaattcaagttaatgttggtcattacatggtgaaacatgagacag |
55092825 |
T |
|
| Q |
91 |
aagccaatggtagtagtttggtagagttgtatttaggctatggattctgtaggatttgcttggaataaggcttttatttatggtcaaaaagtattcacta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55092826 |
aagccaatggtagtagtttggtagagttgtatttaggctatggattctgtaggatttgcttggaataaggcttttatttatggtcaaaaagtattcacta |
55092925 |
T |
|
| Q |
191 |
atattcttcga |
201 |
Q |
| |
|
||||||||||| |
|
|
| T |
55092926 |
atattcttcga |
55092936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University