View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20038_high_6 (Length: 384)
Name: NF20038_high_6
Description: NF20038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20038_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 132 - 366
Target Start/End: Original strand, 45689851 - 45690085
Alignment:
| Q |
132 |
tactcgccaacgcttgagggtctcgggaggagcatttttggtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45689851 |
tactcgccaacgcttgagggtctcgggaggagcatttttggtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttg |
45689950 |
T |
|
| Q |
232 |
gcagcggggctgtgagggtgagtgctgctagcaatggtgacggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtct |
331 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45689951 |
gcagcggggccgtgagggtgagtgctgctagcaatggtgacggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtct |
45690050 |
T |
|
| Q |
332 |
tcatgttttgcatgctattgctcatcttcctcttc |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45690051 |
tcatgttttgcatgctattgctcatcttcctcttc |
45690085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University