View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20038_low_15 (Length: 234)
Name: NF20038_low_15
Description: NF20038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20038_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 47674094 - 47674295
Alignment:
| Q |
12 |
atgcagaaaatagaaaatgatgctggactatatttcattttatacggattatcctctaatattaaaaggtttagtcctacttgctccattccaaattagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
47674094 |
atgcagaaaatagaaaatgatgctggaatatagttcattttatacggattatac-------------ggattagtcctacttgctccattccaaattagc |
47674180 |
T |
 |
| Q |
112 |
agttgtttaagattgctatgcaaatattaagaaaaataataataaatttgctaatggacatggtagttttactaaattaaccctattcgttaataaatgc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47674181 |
agttgtttaagattgctatgcaaatattaagaaaagtaataataaatttgctaatggacatggtagttttactaaattaaccctattcgttaataaatgc |
47674280 |
T |
 |
| Q |
212 |
atgcttgatgatgtc |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47674281 |
atgcttgatgatgtc |
47674295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University