View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20041_low_4 (Length: 333)
Name: NF20041_low_4
Description: NF20041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20041_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 22 - 318
Target Start/End: Complemental strand, 812910 - 812613
Alignment:
| Q |
22 |
atccctttccccctt-atgaaactatttaatggggtggtgcggttgtgtagagattgtttataattgactttcttagtaattcaaatttgnnnnnnngtg |
120 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
812910 |
atccctttcccccctcatgaaactatttaatggggtggtgcggttgtgcagagattgtttataattgactttcttagtaattcaattttttttttttgtg |
812811 |
T |
|
| Q |
121 |
tacttatggggtattatattgtattgttttgttttcatgagacatgctttaaaatgtattatgagatgtatgtaaaatttaattaattgtgcttcttaat |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
812810 |
tacttatggggtattgtattgtattgttttgttttcatgagatatgctttaaaatgtattatgagatgtatgtaaaatttaattaattgtgcttcttaat |
812711 |
T |
|
| Q |
221 |
aagtagcagccctttagttgcaacggaagagcttgcttggatgcacaaaccagctaagataataatattccactagcaagagtgctcaggatatatat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
812710 |
aagtagcagccctttagttgcaacggaagagcttgtttggatgcacaaaccagctaagataataatattccactagcaagagtgctcaggatatatat |
812613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 218
Target Start/End: Original strand, 14306468 - 14306516
Alignment:
| Q |
170 |
taaaatgtattatgagatgtatgtaaaatttaattaattgtgcttctta |
218 |
Q |
| |
|
||||||||||||||||||| || | ||||||||| |||||||||||||| |
|
|
| T |
14306468 |
taaaatgtattatgagatggatatgaaatttaatcaattgtgcttctta |
14306516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University