View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20042_high_16 (Length: 346)
Name: NF20042_high_16
Description: NF20042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20042_high_16 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 118 - 346
Target Start/End: Original strand, 3538303 - 3538532
Alignment:
| Q |
118 |
tggaagccaagtatgtggttagcaaaatcatattttgcttcggctaagaaacacttgggaaagggttataaagagcctcactcaacca-aaggagacatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3538303 |
tggaagccaagtatgtggttagcaaaatcatattttgcttcggctaagaaacacttgggaaagggttataaagagcctcactcaaccataaggagacatt |
3538402 |
T |
 |
| Q |
217 |
tattatgaagacttttactagcaagtaagtgcagtgccctcaaggtaccgaataagataaactggcaccacattgtcaggatgaacgaattcatcaccac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3538403 |
tattatgaagacttttactagcaagtaagtgcactgccctcaaggtaccgagtaagataaactggcaccacattgtcaggatgaacgaattcatcaccac |
3538502 |
T |
 |
| Q |
317 |
cataggccatcatcaacgatgaagctgctt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3538503 |
cataggccatcatcaacgatgaagctgctt |
3538532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 3538279 - 3538210
Alignment:
| Q |
1 |
ataaataaaaacatgtaagtagtgcatctcttatgggaaataacataatgtttatttttctcaacaaaac |
70 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3538279 |
ataaataaaaacatgtaagtagtgcatttcttatgggaaataacataatgtttattttcctcaacaaaac |
3538210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University