View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20042_high_24 (Length: 259)
Name: NF20042_high_24
Description: NF20042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20042_high_24 |
 |  |
|
| [»] scaffold1333 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1333 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: scaffold1333
Description:
Target: scaffold1333; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 1866 - 1708
Alignment:
| Q |
18 |
attaactattttactcgtaaagaattttagcttaattttacaatgtgcactgcatcaatcattttattttataacattttttgagagactgtcaaatcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1866 |
attaactattttactcgtaaagaattttagcttaattttacaatgtgcactgcatcaatcattttattttataacattttttgagagactgtcaaatcct |
1767 |
T |
 |
| Q |
118 |
ttgcaagtttcagcactagacagattcagctaaactctttgtttggtttgatggtttga |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1766 |
ttgcaagtttcagcactagacagattcagctaaactctttgtatggtttgatggtttga |
1708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University