View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20042_high_30 (Length: 219)
Name: NF20042_high_30
Description: NF20042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20042_high_30 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 51511095 - 51510875
Alignment:
| Q |
1 |
tttcccatactcacaaggcacagaaagaaaacatgcctttgctggataaggtgcgtgtgtatgtgtgtgt--ttcaaacatgtttacttgttgtagcttc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51511095 |
tttcccatactcacaaggcacagaaagaaaacatgcctttgctggataaggtgcgtgtgtatgtgtgtgtgtttcaaacatgtttacttgttgtagcttc |
51510996 |
T |
 |
| Q |
99 |
tcgttgccatttctaacttttcacttcatttttctaaccttgttgtagattttagctgagagagcatcattatatgactatgaattgattgttggagaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51510995 |
tcgttgccatttctaacttttcacttcatttttctaaccttgttgtagattttagctgagagagcatcattatatgactatgaattgattgttggagaaa |
51510896 |
T |
 |
| Q |
199 |
atgggaaaagattacttgcat |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51510895 |
atgggaaaagattacttgcat |
51510875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University