View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20042_high_8 (Length: 489)
Name: NF20042_high_8
Description: NF20042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20042_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 12 - 489
Target Start/End: Original strand, 9496134 - 9496625
Alignment:
| Q |
12 |
atgaataggacagtggatgatatggttgctttctcttcttcatatagtacaaatggtttagcatctccaacagctgcaacattttgctctccctttgatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496134 |
atgaataggacagtggatgatatggttgctttctcttcttcatatagtacaaatggtttagcatctccaacagctgcaacattttgctctccctttgatc |
9496233 |
T |
 |
| Q |
112 |
ctgtagggactggg--------------ttatgtaatgtctggtaatgatgtacctgggaaagtgttgcattcttcatcagttacagatgcagcagtgga |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9496234 |
ctgtagggactgggacccagactgttggttatgtaatgtctggtaatgatgtacctgggaaagtgttgcattcttcatcagttacagattcagcagtgga |
9496333 |
T |
 |
| Q |
198 |
tgatgatgcttctagttctttgggtaataacttacctggagaaattgaagggaaggctggtgattcacatacatatccaattctaaggccaataattatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9496334 |
tgatgatgcttctagttctttgggtaataacttacctggagaaattgaagggaaggctggtgattcacatccatatccaattctaaggccaataattatt |
9496433 |
T |
 |
| Q |
298 |
cctaacttgtctagggaaaggtctatatgtgttgatcataaaagcctttgtgttcctcctaccaggcgggagcagcctcgcataaagcagccaccatcac |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9496434 |
cctaacttgtctagggaaaggtctatatgtgttgatcataaaagcccttgtgttcctcctaccaggcgggagcagcctcgcataaagcggccaccatcac |
9496533 |
T |
 |
| Q |
398 |
ccatggtgctttgtgtaccacgtgcaccacaccctcctccaccctcccctgtgagtgactccaggaaacaaaggggttttccaactgttagg |
489 |
Q |
| |
|
|| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496534 |
ccgtggtgctttgtgtaccacgtgcaccacgccctcctccaccctcccctgtgagtgactccaggaaacaaaggggttttccaactgttagg |
9496625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University