View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20042_low_21 (Length: 322)
Name: NF20042_low_21
Description: NF20042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20042_low_21 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 146 - 322
Target Start/End: Complemental strand, 4188688 - 4188512
Alignment:
| Q |
146 |
ggggttggtaagcataagatgaacttttgcgtgtggtatgaatccttaaaagtgctagctgttaagaccgcaacatgtggagaaatatgttgatggtgac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4188688 |
ggggttggtaagcataagatgaacttttgcgtgtggtatgaatccttaaaagtgctagctgttaagaccgcaacatgtggagaaatatgttgatggtgac |
4188589 |
T |
 |
| Q |
246 |
tttgcttttggagaagagagaggtgtcattttggacttttattagtgtagaagaaaaggttaaaggagaaaccgaac |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4188588 |
tttgcttttggagaagagagaggtgtcattttggacttttattagtgtagaagaaaaggttaaaggagaaaccgaac |
4188512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 4188853 - 4188715
Alignment:
| Q |
7 |
tcgaagaatatataacatgtaaatgattttataggtggaagattttaaggaattctctctcaagcttgaaagttgaaaatgtttgctaacttaaagcctg |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4188853 |
tcgaataaaatataacatgtaaatgattttataggtggaagattttaaggaattctctctcaagcttgaaagttgaaaatgtttgctaacttaaagcctg |
4188754 |
T |
 |
| Q |
107 |
tcttgttacgtaattgaaaaagatagcaaaatgcttaat |
145 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
4188753 |
tcttgctatgtaattggaaaagatagcaaaatgcttaat |
4188715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University