View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20042_low_29 (Length: 236)
Name: NF20042_low_29
Description: NF20042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20042_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 52 - 225
Target Start/End: Original strand, 24282631 - 24282804
Alignment:
| Q |
52 |
tatcatccacatgaagcatacaaaaatagttatcgtgcgggtattggaaagtcaccatatgaagctttgtatggatggtagtgtcagacacctttatgtt |
151 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24282631 |
tatcatccacatgaagcttacaaaaatagttatcgtgcgggtattggaaaggcgccatatgaagctttgtatggatggtagtgtcagacacatttatgtt |
24282730 |
T |
|
| Q |
152 |
agtatcatgatggtggagtatgttgatagaccattagaatttgagcaagaagatcatctatttcttcatctcac |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
24282731 |
agtatcatgatggtggagtatgttgatagaccattagaatttgagcaagaagatcgtctatttcttcatatcac |
24282804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University