View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20044_low_16 (Length: 260)
Name: NF20044_low_16
Description: NF20044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20044_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 43915420 - 43915187
Alignment:
| Q |
1 |
tgattgaggattggcaacttcgccgtgagaaaagtcacctaaggcggcgccggtgtttttaagggaggttgagtaggcggtgtgagcggcggcgaaagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43915420 |
tgattgaggattggcaacttcgccgtgagaaaagtcacctaaggcggcgccggtgtttttaagggaggttgagtaggcggtgtgagcggcggcgaaagca |
43915321 |
T |
|
| Q |
101 |
ttacgagatgaaacagcttctttcatgtaacgctttcgttctttgcatcggagaattgattcttcgttctcgatcttcgattgattacaacccattgcgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43915320 |
ttacgagatgaaacagcttctttcatgtaacgctttcgttctttgcatcggagaattgattcttcgttctcgatcttcgattgattacaacccattgcgt |
43915221 |
T |
|
| Q |
201 |
ttgatttgatttactcaattgaagtggtgaatag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43915220 |
ttgatttgatttactcaattgaagtggtgaatag |
43915187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University