View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20044_low_18 (Length: 236)
Name: NF20044_low_18
Description: NF20044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20044_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 63 - 188
Target Start/End: Complemental strand, 29524266 - 29524138
Alignment:
| Q |
63 |
ttttcttatcaaatcgacgagtgaataaatcctgagctagctatttccataagtatccaagat--ttagctagtccaaaaatcaaattttcaattaaatt |
160 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29524266 |
ttttcttatcaaatcgacgagtgaatgcatcctgagctagctatttccataagtatccatgattattagctagtccaaaaatcaaattttcaattaaatt |
29524167 |
T |
 |
| Q |
161 |
ctagcgagatagataatgt-atgtgtcat |
188 |
Q |
| |
|
||| ||||||||||||| ||||||||| |
|
|
| T |
29524166 |
atagtaagatagataatgtaatgtgtcat |
29524138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 29524359 - 29524310
Alignment:
| Q |
1 |
aatcgattgggagaagttggttccggatcttaaaaattaatgcaaattct |
50 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29524359 |
aatcgtttgggagaagttgattccggatcttcaaaattaatgcaaattct |
29524310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University