View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20044_low_19 (Length: 227)
Name: NF20044_low_19
Description: NF20044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20044_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 209
Target Start/End: Complemental strand, 42235638 - 42235448
Alignment:
| Q |
16 |
ataggtactcttagctatatctgactttattatatacaggaaaaagatgggatgggtgtgggtcaaaggccaaaagcatgggatactttgaggctgagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42235638 |
ataggtactcttagctatatctgactttat---atacaggaaaaagatgggatgggtgtgggtcaaaggccaaaagcatgggatactttgaggctgagat |
42235542 |
T |
 |
| Q |
116 |
aatatgattgactctcctcccccactaatcatcaattagttgagtggtctatgcggtgaggatgatgtgatgggtgtaaatgatttggtgcata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42235541 |
aatatgattgactctcctcccccactaatcatcaattagttgagtggtctatgcggtgaggatgatgtgatgggtgtaaatgatttggtgcata |
42235448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University