View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20045_high_20 (Length: 293)
Name: NF20045_high_20
Description: NF20045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20045_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 49522468 - 49522337
Alignment:
| Q |
1 |
tgaagaaggatggggttttatccagcaaggtatcaagaaactcaagaacaatctagaaggctttgaaggctttcatgagactcctcagttcactgctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
49522468 |
tgaagaaggatggggttttatccagcaaggtatcaagaaactcaagaataatctagaaggcttt---------catgagactc---agttcactgctgac |
49522381 |
T |
 |
| Q |
101 |
gattactcgttgctatatacgtacgtacgtttccctgaaacaat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49522380 |
gattactcgttgctatatacgtacgtacgtttccctgaaacaat |
49522337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 210 - 278
Target Start/End: Complemental strand, 49522270 - 49522202
Alignment:
| Q |
210 |
agaaccatctaccgtatgtgcagtcaaaagcttcctcatgactattccatgatcctgtatgacaagtat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49522270 |
agaaccatctaccgtatgtgcagtcaaaagcttcctcatgactattccatgatcctgtatgacaagtat |
49522202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University