View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20045_high_24 (Length: 234)
Name: NF20045_high_24
Description: NF20045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20045_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 121 - 216
Target Start/End: Complemental strand, 12944784 - 12944689
Alignment:
| Q |
121 |
aatcaatgaattttttctctttgtggtttaggatttgaaaatccgagttccgcatgttgtcatcaagcaggtcgatatggaggattggtcacttgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12944784 |
aatcaatgaattttttctctttgtggtttaggatttgaaaatccgagttccgcatgttgtcatcaagcaggtcgatatggaggattggtcacttgt |
12944689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 15 - 121
Target Start/End: Complemental strand, 12944943 - 12944837
Alignment:
| Q |
15 |
taattctttatgcagatgcttaccacattactcaagatatgatcaagaattatcaaaaatatggtaacattaatcattttcgtttaccacgtttcttttg |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12944943 |
taattctttatgcagatgcttacgacattactcaagatatgatcaagaattataaaaaatatggtaacattcatcattttcgtttaccacgtttcttttg |
12944844 |
T |
 |
| Q |
115 |
tttgaaa |
121 |
Q |
| |
|
||||||| |
|
|
| T |
12944843 |
tttgaaa |
12944837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University