View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20045_low_24 (Length: 280)
Name: NF20045_low_24
Description: NF20045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20045_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 45523059 - 45522801
Alignment:
| Q |
16 |
ataatattgtcatttatgccaagtacagacttggaaaggtggatcaggtcctcacactgcttggtgagatggatagaaatggattttctccagattttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45523059 |
ataatattgtcatttatgccaagtacagacttggaaaggtggatcaggtcctcacactgcttggtgagatggatagaaatggattttctccagattttca |
45522960 |
T |
|
| Q |
116 |
tacctacaacattcttcttcatgctatcagtaaaggggatatcggtaaaggggatctcgataaagaggatctcggtaaagaaaaggaacaatttaaagcg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45522959 |
tacctacaacattcttcttcatgctatcagtaaaggggatatcggtaaaggggatctcgataaagaggatctcggtaaagaaaaggaacaatttaaagct |
45522860 |
T |
|
| Q |
216 |
cttaaacttttgaattacatgagagaaacaggtatagagcctactgtacttcatctcac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45522859 |
cttaaacttttgaattacatgagagaaacaggtatagagcctactgtacttcatttcac |
45522801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 262
Target Start/End: Complemental strand, 16191140 - 16191098
Alignment:
| Q |
220 |
aacttttgaattacatgagagaaacaggtatagagcctactgt |
262 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
16191140 |
aacttttgaatcacatgagagaaagaggtatagagccaactgt |
16191098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University