View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20045_low_31 (Length: 212)
Name: NF20045_low_31
Description: NF20045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20045_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 35287605 - 35287797
Alignment:
| Q |
1 |
ggatgaaccgccattaaattggtttgatagaatgaaagtggcagaagctgcatctaaaggactagagtacctgcatgacagtgccaatccaccaattata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35287605 |
ggatgaaccgccattaaattggtttgatagaatgaaagtggcagaagctgcatctaaaggactagagtacctgcatgacagtgccaatccaccaattata |
35287704 |
T |
|
| Q |
101 |
taccgcgactttaaagcattcaacatcttgttggatgttgatcttaatgcaaaactatacgatttcggaatggtcaaactctctggtggagac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
35287705 |
taccgcgactttaaagcattcaacatcttgttggatgttgatcttaatgcaaaactatatgatttcggaatggtcaaattttctggtggagac |
35287797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University