View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20046_low_15 (Length: 280)
Name: NF20046_low_15
Description: NF20046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20046_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 28669592 - 28669370
Alignment:
| Q |
18 |
ggtggttataacaaatttatcagtgtcttgatgggactcttctttcttttaaccgtatcttcacttgtccaagattaataaattgaatgtactgttttct |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28669592 |
ggtggttataacaaatttattagtgtcttgataggactcttctttcctttaaccgtatcttcacttgtccaagattaataaattgaatgtactgttttct |
28669493 |
T |
 |
| Q |
118 |
taatagccttaaccaaatggaactcttctttattaagcaaagaagtgctctgctcaacacgtcccacgctaagcatgagtgttagattatgatagaaaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
28669492 |
taatagccttaaccaaatggaactcttctttattaagcaaagaagtgctctgctcaagacatcccacggtaagtatgagtgttagattatgatagaaaaa |
28669393 |
T |
 |
| Q |
218 |
ctctatgaaaaatgctaataaat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28669392 |
ctctatgaaaaatgctaataaat |
28669370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University