View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20047_high_5 (Length: 440)
Name: NF20047_high_5
Description: NF20047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20047_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 202 - 385
Target Start/End: Complemental strand, 382437 - 382247
Alignment:
| Q |
202 |
ttgaagaagaactgaattggtagcatcagatgctgattg-------ctgatttcaatcactattacatgaatctagaacttttatttttggttatctttc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
382437 |
ttgaagaagaactgaattggtagcatcagatgctgattgaagattgctgatttcaatcactattacatgaatctagaacttttatttttggttatctcta |
382338 |
T |
|
| Q |
295 |
ttattataaatgttattatgaatgaatgtaacaaaatgtaatccaatgcttatgcttcctttatttgcttaaaattaacatgcgagtgttc |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
382337 |
ttattataaatgttattatgaatgaatgtaacaaaatgtaatccaatgcttatgcttcctttatttgcttaaaattatcatgtgagtgttc |
382247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 9 - 144
Target Start/End: Complemental strand, 382627 - 382492
Alignment:
| Q |
9 |
gagatgaactgcttcgaggttgctttcacatccttttcttgtgagaaatggttctaatcataatcagagtcctccaaatatgcatcagttacttcctcca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
382627 |
gagatggactgcttcgaggttgctttcacatccttttcttgtgagaaatggttctaatcataatcagagtcctccaaatatgcatcagttacttcctcca |
382528 |
T |
|
| Q |
109 |
ccaccaagatcacaatcttcttagttcggcaatgta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
382527 |
ccaccaagatcacaatcttcttagttcgtcaatgta |
382492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University