View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20047_low_19 (Length: 268)
Name: NF20047_low_19
Description: NF20047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20047_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 143 - 251
Target Start/End: Complemental strand, 40633040 - 40632932
Alignment:
| Q |
143 |
atttgaggaaattagccgcagcagcttgcagaggctcaaagggcaaaaaggaagtgtagaaaagaatctgggtgaatattgaaaagaggtccagttttta |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40633040 |
atttgaggaaattagccgcagcagcttgcagaggctcaaagggcaaaaaggaagtgtagaaaagaatctgggtgaatattgaaaagaggtccagttttta |
40632941 |
T |
 |
| Q |
243 |
gtgggtatt |
251 |
Q |
| |
|
||||||||| |
|
|
| T |
40632940 |
gtgggtatt |
40632932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 40633158 - 40633124
Alignment:
| Q |
1 |
aaaatgtactaaaagtaggcagaagaacatattga |
35 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40633158 |
aaaatgtactaaaagtaggcagaagaatatattga |
40633124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University