View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20047_low_20 (Length: 260)
Name: NF20047_low_20
Description: NF20047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20047_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 36596065 - 36595831
Alignment:
| Q |
16 |
caaataaccgaacaccgtcgttttctatcgccgccgtgcacggccaactccgtcgtcttcaactcttatgcaaaatccgatcgactgcgttccgcgactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36596065 |
caaataaccgaacaccgtcgttttctatcgccgccgtgcacggccaactccgtcgtcttcaactcttatgcaaaatccgatcgactgcgttccgcgactc |
36595966 |
T |
|
| Q |
116 |
tcgtcgtcggcagggacggaattcccggtcactcaccggcggtggcctttagaatatcgtgtagatgaagaagcaaggaaagaacaacaacggttccaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36595965 |
tcgtcgtcggcagggacggaattcccggtcactcaccggcggtggcctttagaatatcgtgtagatgaagaagcaaggaaagaacaacaacggttccaag |
36595866 |
T |
|
| Q |
216 |
agcaatggattcgttccttcttcattcaagttcat |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36595865 |
agcaatggattcgttccttcttctttcaagttcat |
36595831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University