View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20047_low_24 (Length: 218)
Name: NF20047_low_24
Description: NF20047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20047_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 201
Target Start/End: Original strand, 4257581 - 4257771
Alignment:
| Q |
11 |
tagcaaaggggtttgttaaacatgaagtgggaaaatctttggaggaagttggagaggaatatttgacagagttgatccacagaagtttggttcatgtctc |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4257581 |
tagcagaggggtttgttaaacatgaagtgggaaaatctttggaggaagttggagaggaatatttgacagagttgatccacagaagtttggttcatgtctc |
4257680 |
T |
|
| Q |
111 |
ccgtgttcaatatgatggttaagcgacaagctgtcgaatccatgatttgttacgagaaatgatcatgagaaaaatgaaggatttgagtttt |
201 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4257681 |
ccgtgttcactatgatggtaaagcgacaagctgtcgaatccatgatttgttacgagaaatgatcatgagaaaaatgaaggatttgagtttt |
4257771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 2760223 - 2760274
Alignment:
| Q |
149 |
tccatgatttgttacgagaaatgatcatgagaaaaatgaaggatttgagttt |
200 |
Q |
| |
|
|||||||||| || || ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2760223 |
tccatgatttattgcgggaagtgatcattagaaaaatgaaggatttgagttt |
2760274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University