View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20047_low_25 (Length: 208)
Name: NF20047_low_25
Description: NF20047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20047_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 194
Target Start/End: Original strand, 37199974 - 37200154
Alignment:
| Q |
14 |
cacagacggtatggtgagcattggttattgtaatcttgttatatcctatcgaaaacacaacttgcatattttggtcttgtaaaacttatcttgttacctg |
113 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37199974 |
cacagacgatatggtgagcattggttattgtaatcttgttatatcctgtcgaaaacacaacttgcatattttggtcttgtaaaacttaccttgttacctg |
37200073 |
T |
|
| Q |
114 |
cattcacatatccttcaatactgaaaagacatgatacatgtctaatgtaaatcaaggttgatacatatgtgcacatttatg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37200074 |
cattcacatatccttcaatactgaaaagacatgatacatgtctaatgtaaatcaaggttgatacatatgtgcacatttatg |
37200154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University