View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20048_high_14 (Length: 250)
Name: NF20048_high_14
Description: NF20048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20048_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 234
Target Start/End: Complemental strand, 33613976 - 33613746
Alignment:
| Q |
4 |
atccggccccgacaaatttcagcttccatcaataggtcttaaagatattttttgggcatgtccctttacctaggattcaatctcttttgctgagtcagcc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33613976 |
atccggccccgacaaatttcagcttccat-aataggtcttaaagatattttttgggcatgtccctttacctaggattcaatctcttttgctgagtcagcc |
33613878 |
T |
 |
| Q |
104 |
tggtgtgggaccctttcaccaatttgagaccttgcagatacttggtcttgttaataatacacaccaacttgatcaattaaatttaatctagtactactag |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33613877 |
tggtgtgggaccctttcacaaatttgagaccttgcagatacttggtcttgttaataatacacaccaacttgatcaattaaatttaatctagtactactag |
33613778 |
T |
 |
| Q |
204 |
cacttactt-ttttcattatggtacattattt |
234 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
33613777 |
cacttactttttttcattatggtacattattt |
33613746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 33625981 - 33625929
Alignment:
| Q |
149 |
tcttgttaataatacacaccaacttgatcaattaaatttaatctagtactact |
201 |
Q |
| |
|
|||||| ||| |||||||||||| |||| |||| |||||||| |||||||||| |
|
|
| T |
33625981 |
tcttgtcaatcatacacaccaacctgattaattgaatttaatttagtactact |
33625929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University