View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20048_low_10 (Length: 280)
Name: NF20048_low_10
Description: NF20048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20048_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 26135466 - 26135216
Alignment:
| Q |
18 |
atggtggtactaattggagcaatatactgagcttgtgagctgaattgtatggctgtataagcatggttattcatagaagggatgcgatagggaaagtcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26135466 |
atggtggtactaattggagcaatatactgagcttgtgagctgaattgtatggctgtataagtatggttattcatagaagggatgcgatagggaaagtcca |
26135367 |
T |
|
| Q |
118 |
cactaatagtctaagaagaacactaagtttttcaagaaagttgagggcaggatgtgagaaacatgtgttgtattgaatgcaaatttgattgagtttatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26135366 |
cactaatagtctaagaagaacactaagtttttcaagaaagttgagggcaggatgtgagaaacatgtgttgtattgaatgcaaatttgattgagtttatgt |
26135267 |
T |
|
| Q |
218 |
ttttataaggttgaatttcaaccattctgggtatgttttcatgaaggccta |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26135266 |
ttttataaggttgaatttcaaccattctgggtatgttttgatgaaggccta |
26135216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 7954436 - 7954485
Alignment:
| Q |
21 |
gtggtactaattggagcaatatactgagcttgtgagctgaattgtatggc |
70 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
7954436 |
gtggtactaattgaagcaatatattgagcttgtgagctgaattgtttggc |
7954485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University