View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20048_low_11 (Length: 278)
Name: NF20048_low_11
Description: NF20048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20048_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 24 - 261
Target Start/End: Complemental strand, 26880182 - 26879945
Alignment:
| Q |
24 |
cttgtacatattatacaatttacgctgggtttatttaaaggaatgaaccgctgtgtaggagtaggaagaaaagacactgagcgataagatgatactacac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26880182 |
cttgtacatattatacaatttacgctgggtttatttaaaggaatgaaccgctgtgtaggagcaggaagaaaagacactgagcgataagatgatactacac |
26880083 |
T |
 |
| Q |
124 |
acatgcattgtcacgcacatttgaaaccgcctttgaaattttgttatttattgttttactggtatattttaaatcacattcaaatgtcaggttttatctt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26880082 |
acatgcattgtcacgcacatttgaaaccgcctttgaaattttgttatttattgttttactggtatattttaaatcacattcaaatgtcaagttttatctt |
26879983 |
T |
 |
| Q |
224 |
cgtacttactagatctttgcgttttttctgcttttgct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26879982 |
cgtacttactagatctttgcgttttttctgcttttgct |
26879945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University