View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20048_low_16 (Length: 246)
Name: NF20048_low_16
Description: NF20048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20048_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 7246239 - 7246460
Alignment:
| Q |
6 |
agaataagatgttgagtccaaaaagaggtgatgagtagtagcatcttgagtttgaaaatgagaatgatcaagtggtttagaagaggtaattgattgagag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
7246239 |
agaataagatgttgagtccaaaaagaggtgatgagtagtagcatcttgagtttgaaaatgagaatgatcaagtgggttagtagaggtaattgattgagag |
7246338 |
T |
 |
| Q |
106 |
taatagtaagggtttaaagaagagttttgataggattgtgaaaaagattgtgactgatcatgacaagccatggatgaagtagagaaagggaaagaagaag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7246339 |
taatagtaagggtttaaagaagagttttggtaggattgtgaaaaagattgtgactgatcatgacaagccatggatgaagtagagaaagggaaagaagaag |
7246438 |
T |
 |
| Q |
206 |
gtgagtttatgctgctgctgtt |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7246439 |
gtgagtttatgctgctgctgtt |
7246460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University