View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20049_high_2 (Length: 278)
Name: NF20049_high_2
Description: NF20049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20049_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 23670916 - 23670674
Alignment:
| Q |
18 |
attaaaaccctataataagtcccttgaaggtaacaatgtgcttgtgaattgaaggtaataatgtgattatgaatttaataagaattcgtttgaaggcgat |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23670916 |
attaaaaccctataataagtaccttgaaggtaacaatgtgcttgtgaattgaaggtaataatgtgattatgaatttaataagaattcgtt-gaaggcgat |
23670818 |
T |
 |
| Q |
118 |
gatgttgaggctaagtttgaatgaagaagtcgtttgaaggcgacaagcaagaaagcaaccccttttgctgatccaagcaagcattgcatttcatttctaa |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23670817 |
gatgttgaggcaaagtttgaatgaagaagtcgtttgaaggcgacaagcaagcgggcaacaccttttgctgatccaagcaagcattgcatttcatttctaa |
23670718 |
T |
 |
| Q |
218 |
actcaaaagtaannnnnnnngttataatttttgggcctctcgtg |
261 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23670717 |
actcaaaagtaattttttttgttataatttttgggcctctcgtg |
23670674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University