View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2004_high_4 (Length: 362)
Name: NF2004_high_4
Description: NF2004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2004_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 20 - 356
Target Start/End: Original strand, 9433291 - 9433627
Alignment:
| Q |
20 |
gatatctccggtgagcttcaacggttggcgacgttaccgtcgccggagtgtgacggtggaagtggtggtggaggtgatggtgtggttgaagttgttgaac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9433291 |
gatatctccggtgagcttcaacggttggcgacgttaccgtcgccggagtgtgacggtggaagtggtgttggaggtgatggtgtggttgaagttgttgaac |
9433390 |
T |
 |
| Q |
120 |
cggagccttgcatggggtttttacaaagagagaatttctcgacggagattattgagagtatttcgccggaggatcttcaaccgacggtgaagctttgtgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433391 |
cggagccttgcatggggtttttacaaagagagaatttctcgacggagattattgagagtatttcgccggaggatcttcaaccgacggtgaagctttgtgt |
9433490 |
T |
 |
| Q |
220 |
ggatggtttacagtcttcttcagtggctgtgaaacggtctgctgcggcgaaattgaggttgcttgcaaagaatcgagctgataatcgtgttttgatcggt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433491 |
ggatggtttacagtcttcttcagtggctgtgaaacggtctgctgcggcgaaattgaggttgcttgcaaagaatcgagctgataatcgtgttttgatcggt |
9433590 |
T |
 |
| Q |
320 |
gaatccggtgctgtacctttgcttgttcctttgcttc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433591 |
gaatccggtgctgtacctttgcttgttcctttgcttc |
9433627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University