View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20050_high_15 (Length: 330)
Name: NF20050_high_15
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20050_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 173 - 315
Target Start/End: Complemental strand, 25778615 - 25778473
Alignment:
| Q |
173 |
ctaaatttcgatgctagctacatgaagataacacatccaattgtttttcagaaatcatattgttcggtacattatacagatgcagaatccaagtgccata |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25778615 |
ctaaatttcgatgctagctacatgaagataacatatccaattgtttttcagaaatcatattgttcagtacattatacagatgcagaatccaagtgccata |
25778516 |
T |
 |
| Q |
273 |
gcagaacttactgctcagttcaatgggaaatatgtacaactct |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25778515 |
gcagaacttactgctcagttcaatgggaaatatgtacaactct |
25778473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 25778766 - 25778656
Alignment:
| Q |
19 |
acaagtacttatgtcaatagataatctcaatcaaactaatccaaacaaaccctaatatatatatttgatacttacgggcatattcttgaaggatagtagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25778766 |
acaagtacttatgtcaatagataatcacaatcaaactaatccaaacaaaccctaatat--atatttgatacttattggcatattcttgaaggatagtagt |
25778669 |
T |
 |
| Q |
119 |
aatatggaactgg |
131 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25778668 |
aatatggaactgg |
25778656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 222 - 315
Target Start/End: Original strand, 10182846 - 10182938
Alignment:
| Q |
222 |
agaaatcatattgttcggtacattatacagatgcagaatccaagtgccatagcagaacttactgctcagttcaatgggaaatatgtacaactct |
315 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
10182846 |
agaaatcatattgttcagtacattatacagatgcagaatc-aagtgccatagcagaactaactgctcagttcaaagggaactatgtactactct |
10182938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 73
Target Start/End: Complemental strand, 3968595 - 3968542
Alignment:
| Q |
20 |
caagtacttatgtcaatagataatctcaatcaaactaatccaaacaaaccctaa |
73 |
Q |
| |
|
|||||||||||| || ||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
3968595 |
caagtacttatggcagtagataacctcaaataaactaatccaaacagaccctaa |
3968542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University