View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20050_high_23 (Length: 258)
Name: NF20050_high_23
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20050_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 10 - 243
Target Start/End: Original strand, 40249597 - 40249824
Alignment:
| Q |
10 |
ataatacttcaatactccaacttcttttaatcaaacagcaaattttaacagatttgaatcgtacaatttgaaaaatccaaatgtgtaaaagatcatgaaa |
109 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40249597 |
ataattcttcaatactccaactt---ttaatcaaacagcaaattttaacacatttgagtcgtacaatttgaaaaatccaaatgtgtaaaagatcatgaaa |
40249693 |
T |
 |
| Q |
110 |
atgtctagacaaaggtattaatataacttcctaccaaaattatgtttggctcaacttattttgggtttttctactactcaataagaaaactcttaataaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40249694 |
atgtctagacaaaggtattaatataacttcctaccaaaattatgtttggctcagcttattttgggttttt---ctactcaataagaaaactcttaataaa |
40249790 |
T |
 |
| Q |
210 |
caaaagttgcttaataaataagaaagctcttttt |
243 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |
|
|
| T |
40249791 |
caaaagtagcttaataaataagaaaactcttttt |
40249824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 243
Target Start/End: Original strand, 40250361 - 40250393
Alignment:
| Q |
211 |
aaaagttgcttaataaataagaaagctcttttt |
243 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
40250361 |
aaaagttgcttaataaataagaaaactcttttt |
40250393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University