View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20050_high_31 (Length: 203)
Name: NF20050_high_31
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20050_high_31 |
 | |
|
| [»] scaffold0027 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0027 (Bit Score: 75; Significance: 9e-35; HSPs: 2)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 15 - 93
Target Start/End: Complemental strand, 19608 - 19530
Alignment:
| Q |
15 |
atgaaggctatccagtactaccttagttctttattacatgagataattcatcttttagattgattgaataattgatcta |
93 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19608 |
atgaaggctatccggtactaccttagttctttattacatgagataattcatcttttagattgattgaataattgatcta |
19530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 122 - 188
Target Start/End: Complemental strand, 19539 - 19473
Alignment:
| Q |
122 |
aattaatctaaaaaatagatgttagtaagaaatagagtgtcgtataagtttacaagtaattattatt |
188 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19539 |
aattgatctaaaaaatagatgttagtaagaaatagaatgtcgtataagtttacaagtaattattatt |
19473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University