View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20050_high_9 (Length: 488)
Name: NF20050_high_9
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20050_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 3e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 150 - 286
Target Start/End: Complemental strand, 3116425 - 3116288
Alignment:
| Q |
150 |
cacttgttttgatggaaaatctcaaagcaggggtaaaagacgcatctctggtaccaga-atggtgaaatctactgcttttttagatgcatgcaacctact |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3116425 |
cacttgttttgatggaaaatctcaaagcagaggtaaaagacgcatctcttgtaccagatatggtgaaatctactgcttttttagatgtatgcaacctact |
3116326 |
T |
|
| Q |
249 |
gaactgtgagaatgaagtttttgcaactattgacgagc |
286 |
Q |
| |
|
||||||| | | || |||| |||||||||||| |||| |
|
|
| T |
3116325 |
gaactgtaacagcgaggtttctgcaactattgaagagc |
3116288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University