View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20050_low_15 (Length: 330)

Name: NF20050_low_15
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20050_low_15
NF20050_low_15
[»] chr5 (2 HSPs)
chr5 (173-315)||(25778473-25778615)
chr5 (19-131)||(25778656-25778766)
[»] chr4 (1 HSPs)
chr4 (222-315)||(10182846-10182938)
[»] chr7 (1 HSPs)
chr7 (20-73)||(3968542-3968595)


Alignment Details
Target: chr5 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 173 - 315
Target Start/End: Complemental strand, 25778615 - 25778473
Alignment:
173 ctaaatttcgatgctagctacatgaagataacacatccaattgtttttcagaaatcatattgttcggtacattatacagatgcagaatccaagtgccata 272  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
25778615 ctaaatttcgatgctagctacatgaagataacatatccaattgtttttcagaaatcatattgttcagtacattatacagatgcagaatccaagtgccata 25778516  T
273 gcagaacttactgctcagttcaatgggaaatatgtacaactct 315  Q
    |||||||||||||||||||||||||||||||||||||||||||    
25778515 gcagaacttactgctcagttcaatgggaaatatgtacaactct 25778473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 25778766 - 25778656
Alignment:
19 acaagtacttatgtcaatagataatctcaatcaaactaatccaaacaaaccctaatatatatatttgatacttacgggcatattcttgaaggatagtagt 118  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||  ||||||||||||||  ||||||||||||||||||||||||    
25778766 acaagtacttatgtcaatagataatcacaatcaaactaatccaaacaaaccctaatat--atatttgatacttattggcatattcttgaaggatagtagt 25778669  T
119 aatatggaactgg 131  Q
    |||||||||||||    
25778668 aatatggaactgg 25778656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 222 - 315
Target Start/End: Original strand, 10182846 - 10182938
Alignment:
222 agaaatcatattgttcggtacattatacagatgcagaatccaagtgccatagcagaacttactgctcagttcaatgggaaatatgtacaactct 315  Q
    |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| ||||||| |||||    
10182846 agaaatcatattgttcagtacattatacagatgcagaatc-aagtgccatagcagaactaactgctcagttcaaagggaactatgtactactct 10182938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 73
Target Start/End: Complemental strand, 3968595 - 3968542
Alignment:
20 caagtacttatgtcaatagataatctcaatcaaactaatccaaacaaaccctaa 73  Q
    |||||||||||| || ||||||| |||||  ||||||||||||||| |||||||    
3968595 caagtacttatggcagtagataacctcaaataaactaatccaaacagaccctaa 3968542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University