View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20050_low_17 (Length: 307)
Name: NF20050_low_17
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20050_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 289
Target Start/End: Complemental strand, 19612609 - 19612339
Alignment:
| Q |
20 |
tatttgaatcactaatattcaatacattcaatcataattcggttattgacatgg-tatgacttaatttgagaaacttgctttgattgactattttgttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
19612609 |
tatttgaatcactaatattcaatacattcaatcataattcggttattgacatgggtatgacttaatttgagaaacttgctttgattgattattttcttta |
19612510 |
T |
 |
| Q |
119 |
actcagatttttgctttctatcaattttgggtacatagatttgtcctagttcttccagattaattaatttttgcaaataaactctttagattccctttaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19612509 |
actcagatttttgctttctatcaattttgggtacatagatttgtcctagttcttccagattaattaatttttgcaaatatactctttagattccctttaa |
19612410 |
T |
 |
| Q |
219 |
ttcttgcagttgaattcagatgtctgagacctttaatttgttannnnnnnggacagttcaaatcttaatct |
289 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19612409 |
ttcttggagttgaattcagatgtctgagacctttaatttgttattgttttggatagttcaaatcttaatct |
19612339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University