View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20050_low_21 (Length: 264)
Name: NF20050_low_21
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20050_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 36888188 - 36888096
Alignment:
| Q |
18 |
ataacaaactccgctacgtggaccccacctcaccgcaaactaactctcgccgctgcaaaacaccattttcaccgtcacagtttcattcctccg |
110 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36888188 |
ataacaaactccgttacgtggaccccacctcaccggaaactaactctcgccgccgcaaaacaccattttcaccgtcacagtttcattcctccg |
36888096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 175 - 256
Target Start/End: Complemental strand, 36888031 - 36887950
Alignment:
| Q |
175 |
gcaagaaactacacatggtaattctacatttgcttctcaactttgaaaaccaatgaaaacgcaatgaaaattcacctatgct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
36888031 |
gcaagaaactacacatggtaattctacatttgcttctcaacttcgaaaaccgatgaaaacgcaatgaaaattcacttatgct |
36887950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University