View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20050_low_31 (Length: 203)

Name: NF20050_low_31
Description: NF20050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20050_low_31
NF20050_low_31
[»] scaffold0027 (2 HSPs)
scaffold0027 (15-93)||(19530-19608)
scaffold0027 (122-188)||(19473-19539)


Alignment Details
Target: scaffold0027 (Bit Score: 75; Significance: 9e-35; HSPs: 2)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 15 - 93
Target Start/End: Complemental strand, 19608 - 19530
Alignment:
15 atgaaggctatccagtactaccttagttctttattacatgagataattcatcttttagattgattgaataattgatcta 93  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19608 atgaaggctatccggtactaccttagttctttattacatgagataattcatcttttagattgattgaataattgatcta 19530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 122 - 188
Target Start/End: Complemental strand, 19539 - 19473
Alignment:
122 aattaatctaaaaaatagatgttagtaagaaatagagtgtcgtataagtttacaagtaattattatt 188  Q
    |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
19539 aattgatctaaaaaatagatgttagtaagaaatagaatgtcgtataagtttacaagtaattattatt 19473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University