View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20051_high_12 (Length: 206)
Name: NF20051_high_12
Description: NF20051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20051_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 6339355 - 6339530
Alignment:
| Q |
20 |
cactaagcatgcatttcttcatttattataccaacaaaagtttgtggaaaaaa-tgacctannnnnnn-agatgtttaggtgagtagaataaatgttttt |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
6339355 |
cactaagcatgcacttcttcatttattataccaacaaaagtttgtggaaaaaaatgacctattttttttagatatttaggtgaatagaataaatgttttt |
6339454 |
T |
 |
| Q |
118 |
tcaatgagcatggtccagtgcaatcttgactataattg--atatgttactactgcatattaggaatggtccctttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
6339455 |
tcaatgagcatggtccagtgcaatcttgactataattgatatatattaatactacatattaggaatggtccctttg |
6339530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University