View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20051_low_12 (Length: 208)
Name: NF20051_low_12
Description: NF20051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20051_low_12 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 6912793 - 6912613
Alignment:
| Q |
10 |
caagaatatgataaagaacttgaatgttggnnnnnnnnnnatgataacactttggctaaggtatataagcattatagacttcagtattaataattgggtg |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912793 |
caagaaaatgataaagaacttgaatgttggttttttttttatgataacactttggctaaggtatataagcattatagacttcagtattaataattgggtg |
6912694 |
T |
|
| Q |
110 |
atatgctgatcctgaatgatattaatatttttcatatcttgtttacattcccacaacattttatttactttctcaacatct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6912693 |
atatgctgatcctgaatgatattaatatttttcatatcttgtttacattcccacaacattttattcactttctcaacatct |
6912613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 156835 - 156923
Alignment:
| Q |
71 |
tatataagcattatagacttcagtattaataattgggtgatatgctgatcctgaatgatattaatatttttcatatcttgtttacattc |
159 |
Q |
| |
|
|||||||||||| ||| || |||| | |||||| ||||||||||||| |||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
156835 |
tatataagcattgtagcctctagtaattgtaattgcatgatatgctgatcttgaatgcaattattatttttcacatcttgtttacattc |
156923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University