View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20052_high_7 (Length: 348)
Name: NF20052_high_7
Description: NF20052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20052_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 2 - 343
Target Start/End: Original strand, 42717005 - 42717346
Alignment:
| Q |
2 |
cttggtgctcaatctgtttaattttttcccagttcttgatatgcttatcagcttagtcctgaggacaaagatttattgattcagcggttatcaatgtggt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717005 |
cttggtgctcaatctgtttaattttttcccagttcttgatatgcttatcagcttagtcccgaggacaaagatttattgattcagcggttatcaatgtggt |
42717104 |
T |
|
| Q |
102 |
gattggtgtttgatattccggaagaagttcaatttcaaattgggtgctcgttagtctactttatgtcctaaagaaggcccatggtgagattaatcccccg |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717105 |
gattggtgtttgttattccggaagaagttcaatttcaaattgggtgctcgttagtctactttatgtcctaaagaaggcccatggtgagattaatcccccg |
42717204 |
T |
|
| Q |
202 |
acttttcaaagtattgctgcgtggagtgaaataaagagatacactcatatattatttctcttaaaaaatttccttttatgttatctccactgtattaatc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42717205 |
acttttcaaagtattgctgcgtggagtgaaataaagagatacactcatatattatttctcttaaaaaatttccttgtatgttatctccactgtattaatc |
42717304 |
T |
|
| Q |
302 |
ataactgttccattcctgcaggtcaaatcctttcatctcact |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42717305 |
ataactgttccattcctgcaggtcaaatcctttcatttcact |
42717346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University