View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20053_low_10 (Length: 229)
Name: NF20053_low_10
Description: NF20053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20053_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 13290003 - 13290215
Alignment:
| Q |
1 |
gttccacatttgatagaagataatatataagtgataaaacgaatatacctaataccttaaattttttgggtgaatatgtgatgtccaaacttgttgctct |
100 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| | || |||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13290003 |
gttccacattggatagaagcgaatatataagtgagaggaccgatatacttaataccttaagttttttgggtgaatatgtgatgtcaaaacttgttgctct |
13290102 |
T |
 |
| Q |
101 |
taatccaatagttattcaacccaatgttgctcccctaaaagttccaacaatccatgctataatcatccacttagttttactagtgtctcattcttgcctc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13290103 |
taatccaatagttattcaaccaaatgttgctcccctaaaagttccaacaatccatgctataatcatccacttagttttactagtgtctcattgttgcctc |
13290202 |
T |
 |
| Q |
201 |
ggggccattatgt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13290203 |
ggggccattatgt |
13290215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University