View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20053_low_7 (Length: 298)
Name: NF20053_low_7
Description: NF20053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20053_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 33985389 - 33985122
Alignment:
| Q |
18 |
ttatctccctaagaggtgcaaacattacacatattcgagttgtattttatacagtgttagatacgttgtccgatcatggtgtgtctaaataacatgtctc |
117 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33985389 |
ttatctccctaagtgatgccaacattacacatattcgaattgtattttatacggtgttagatacgttgtccgaccatggtgtgtctaaataacatgtctc |
33985290 |
T |
|
| Q |
118 |
taatattaagactaaaattaaagttgaagatatgtaacaaaaataactgaaccaataaacaataacaatatttatttaccagatagcacaggttgaacac |
217 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985289 |
taatattaagactaaaat-aaagttcaagatatgtaacaaaaataactgaaccaataaacaataacaatatttatttaccagatagcacaggttgaacac |
33985191 |
T |
|
| Q |
218 |
tgttcaacaatatggagattgacaacaaaggtgataaatcaccaactgctttagccacatcttggtctg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33985190 |
tgttcaacaatatggagattgacaacaaaggtgataaatcaccaactgctttagccacatctgggtctg |
33985122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 279
Target Start/End: Complemental strand, 33994617 - 33994528
Alignment:
| Q |
190 |
tatttaccagatagcacaggttgaacactgttcaacaatatggagattgacaacaaaggtgataaatcaccaactgctttagccacatct |
279 |
Q |
| |
|
||||||||||| |||||||| || |||||||||| |||||||||| ||| ||||||||||||| ||| |||||||| || ||||||||| |
|
|
| T |
33994617 |
tatttaccagaaagcacaggctggacactgttcattaatatggagaatgataacaaaggtgatagatctccaactgcatttgccacatct |
33994528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University