View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20053_low_9 (Length: 264)
Name: NF20053_low_9
Description: NF20053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20053_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 2948162 - 2948416
Alignment:
| Q |
1 |
ttgttataagctgttcctggaatgttgagagggaatgagatgagtccttgtataaatgcaacaaagttctcccttaaattctcggaggactcggttggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2948162 |
ttgttataagctgttcctggaatgttgagagggaatgagatgagtccttgtataaatgcaacaaagttctcccttaaattctcggaggactcggttggat |
2948261 |
T |
|
| Q |
101 |
cataactgatgagtttt-ttgcagtcaaatcaaatatcatctgaatgataatatataggaaagaaaggtttagactttagacaaggaatggaagaaggtt |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2948262 |
cataactgatgagtttttttgcagtcaaatcaaatatcatctgaatgataatatataggaaagaaaggtttagactttagacaaggaatggaagaaggtt |
2948361 |
T |
|
| Q |
200 |
aaaattgcagaggaatgaaagaatagtttaaagtttgataattttaccgtctctg |
254 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
2948362 |
aaaattgcagaggaatgaaagaatagtgtaaagtttgataattttaccgtttctg |
2948416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University