View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20055_high_15 (Length: 252)
Name: NF20055_high_15
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20055_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 45939343 - 45939109
Alignment:
| Q |
17 |
attatgtaccttgatattgtagcatgatgtcatcttttattccaacca----tccttgatatatggtaaaaaagatccaacgaccaccttttattcacta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45939343 |
attatgtaccttgatattgtagcatgatgtcatcttttattccaaccaaccatccttgatatatggtaaagaagatccaacgaccaccttttattcacta |
45939244 |
T |
|
| Q |
113 |
actctagtgaaattacttctcgctatgaatagtaacgccctttacaaaaatattaag--aaaatnnnnnnnnntgttgacctcaaatattaaaatttaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
45939243 |
actctagtgaaattacttctcgctatgaatagcaacgccctttacaaaaatattaagaaaaaaaaataaaaaatgttgacctcaaatattaaaatttaga |
45939144 |
T |
|
| Q |
211 |
ggtctaaaatgatcaatttagaccatcctatgctt |
245 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45939143 |
ggtctaaaatgatcaatttagaccatcttatgctt |
45939109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University