View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20055_high_19 (Length: 212)
Name: NF20055_high_19
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20055_high_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 3783661 - 3783870
Alignment:
| Q |
1 |
aaaaggttgttgtgttgttgtggatggcgatgatctatgctacttggtatttcatgcagattgtcgtgatagtcctgaaatttcattacccnnnnnnntt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3783661 |
aaaaggttgttgtgtttttgtggatggtgatgatctatgctacttggtatttcatgcagattgtcgtgatagtcctgaaatttcattacccaaaaa--tt |
3783758 |
T |
|
| Q |
101 |
atcttggaaattgtcttgccagtaaaattgtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatagtatcgaaaggaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3783759 |
attttggaaattgtcttgccagtaaaattgtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatggtatcgaaaggaa |
3783858 |
T |
|
| Q |
201 |
gataagagattt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3783859 |
gataagagattt |
3783870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 212
Target Start/End: Complemental strand, 37960549 - 37960467
Alignment:
| Q |
130 |
gtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatagtatcgaaaggaagataagagattt |
212 |
Q |
| |
|
|||| ||||||||| | ||||||| |||||| ||||||||||||| ||||| ||| | ||||||||| |||||||||| |||| |
|
|
| T |
37960549 |
gtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtatcgaaaagaagataagacattt |
37960467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 212
Target Start/End: Original strand, 37915649 - 37915728
Alignment:
| Q |
133 |
gttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatagtatcgaaaggaagataagagattt |
212 |
Q |
| |
|
|||||||| |||| |||||||||||||| | |||| ||| ||| ||| |||||| ||| ||| |||||||||||||||| |
|
|
| T |
37915649 |
gttgtaaataggggtgagttagttggaaaagatggtattcttgtggcggcaaatgctattgaacggaagataagagattt |
37915728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University