View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20055_high_19 (Length: 212)

Name: NF20055_high_19
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20055_high_19
NF20055_high_19
[»] chr8 (1 HSPs)
chr8 (1-212)||(3783661-3783870)
[»] chr2 (2 HSPs)
chr2 (130-212)||(37960467-37960549)
chr2 (133-212)||(37915649-37915728)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 3783661 - 3783870
Alignment:
1 aaaaggttgttgtgttgttgtggatggcgatgatctatgctacttggtatttcatgcagattgtcgtgatagtcctgaaatttcattacccnnnnnnntt 100  Q
    |||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||    
3783661 aaaaggttgttgtgtttttgtggatggtgatgatctatgctacttggtatttcatgcagattgtcgtgatagtcctgaaatttcattacccaaaaa--tt 3783758  T
101 atcttggaaattgtcttgccagtaaaattgtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatagtatcgaaaggaa 200  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
3783759 attttggaaattgtcttgccagtaaaattgtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatggtatcgaaaggaa 3783858  T
201 gataagagattt 212  Q
    ||||||||||||    
3783859 gataagagattt 3783870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 212
Target Start/End: Complemental strand, 37960549 - 37960467
Alignment:
130 gtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatagtatcgaaaggaagataagagattt 212  Q
    |||| ||||||||| | ||||||| |||||| ||||||||||||| ||||| ||| | ||||||||| |||||||||| ||||    
37960549 gtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtatcgaaaagaagataagacattt 37960467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 212
Target Start/End: Original strand, 37915649 - 37915728
Alignment:
133 gttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatagtatcgaaaggaagataagagattt 212  Q
    |||||||| |||| |||||||||||||| | |||| ||| ||| ||| ||||||  ||| ||| ||||||||||||||||    
37915649 gttgtaaataggggtgagttagttggaaaagatggtattcttgtggcggcaaatgctattgaacggaagataagagattt 37915728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University