View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20055_high_7 (Length: 330)
Name: NF20055_high_7
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20055_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 3585367 - 3585552
Alignment:
| Q |
1 |
gtggtgtgaatgaattcagtgccatcgcgtataaggaaggtataagcaatgaggaaggaaaagttaatctccaaggt-----tgtagtgcagtgcaggaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||||||| | |
|
|
| T |
3585367 |
gtggtgtgaatgaattcagtgccatcgcgtataaggaaggtataagcaatgaggaaggaaggaaaaattaacaaggttgtagtgtagtgcagtgcaggta |
3585466 |
T |
 |
| Q |
96 |
gtgattgtggtaagtattaacacacgtgttctagtgttatccaatttttggtaacgccacatgtcaaaagagaaagcatttttcta |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3585467 |
gtgattgtggtaagtattaacacacgtgttctagtgttatccaatttttggtaacgccacatgtcaaaagagaaagcatttttcta |
3585552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 217 - 322
Target Start/End: Original strand, 3585560 - 3585673
Alignment:
| Q |
217 |
ctaaatgacaaaattaccctttgttgagatttaattcccaatttcgccctaaaaccc-------tttcaatcgttctcaagaaaaaccaacccttcc-tt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
3585560 |
ctaaatgacaaaattaccctttgttgagatttaattcacaatttcgccctaaaaccctttcaagtttcaatcgttctcaagaaaaaccaacccttccttt |
3585659 |
T |
 |
| Q |
309 |
tacttgttctctct |
322 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3585660 |
tacttgttctctct |
3585673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University